Transcript: Human NM_001001524.3

Homo sapiens transmembrane 6 superfamily member 2 (TM6SF2), mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
TM6SF2 (53345)
Length:
1518
CDS:
87..1220

Additional Resources:

NCBI RefSeq record:
NM_001001524.3
NBCI Gene record:
TM6SF2 (53345)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001001524.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254083 GACCTGGCCCTTGTCATATAT pLKO_005 738 CDS 100% 15.000 10.500 N TM6SF2 n/a
2 TRCN0000254084 AGGAAACATTCTTGGCAAATA pLKO_005 557 CDS 100% 13.200 9.240 N TM6SF2 n/a
3 TRCN0000254085 AGTCTTGGCTATGGTAGTTTC pLKO_005 1332 3UTR 100% 10.800 7.560 N TM6SF2 n/a
4 TRCN0000265460 TTGTCTATATCTACCAGTATG pLKO_005 829 CDS 100% 10.800 7.560 N TM6SF2 n/a
5 TRCN0000167395 GAAACATTCTTGGCAAATACA pLKO.1 559 CDS 100% 5.625 3.938 N TM6SF2 n/a
6 TRCN0000172828 GTCTTCATCTGCTACTGGGAT pLKO.1 414 CDS 100% 2.640 1.848 N TM6SF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001524.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.