Transcript: Human NM_001002836.4

Homo sapiens zinc finger protein 787 (ZNF787), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ZNF787 (126208)
Length:
1940
CDS:
135..1283

Additional Resources:

NCBI RefSeq record:
NM_001002836.4
NBCI Gene record:
ZNF787 (126208)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001002836.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096195 CCCAGTGGACATCCTCATCAT pLKO.1 209 CDS 100% 4.950 3.465 N Zfp787 n/a
2 TRCN0000107775 CCGGAGAGACAATGGAGAGAA pLKO.1 1536 3UTR 100% 4.950 3.465 N ZNF787 n/a
3 TRCN0000107776 GACATCCTCATCATGGATGAT pLKO.1 216 CDS 100% 0.495 0.347 N ZNF787 n/a
4 TRCN0000107777 GTGGACATCCTCATCATGGAT pLKO.1 213 CDS 100% 3.000 1.800 N ZNF787 n/a
5 TRCN0000107778 CCGCAGCTTCACTCAGAGCAA pLKO.1 602 CDS 100% 0.880 0.528 N ZNF787 n/a
6 TRCN0000107779 GCGCATCCACACGGGCGAGAA pLKO.1 473 CDS 100% 0.000 0.000 Y ZNF787 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001002836.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.