Transcript: Human NM_001002901.3

Homo sapiens Fc receptor like B (FCRLB), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
FCRLB (127943)
Length:
2013
CDS:
235..1515

Additional Resources:

NCBI RefSeq record:
NM_001002901.3
NBCI Gene record:
FCRLB (127943)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001002901.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427484 ATAAGCCTAGCCAGTACATAT pLKO_005 1801 3UTR 100% 13.200 18.480 N FCRLB n/a
2 TRCN0000416139 TATCCAATGATTGGCTGATTC pLKO_005 533 CDS 100% 10.800 15.120 N FCRLB n/a
3 TRCN0000179079 CCGCAAGCATTCTCTTTGAAT pLKO.1 1689 3UTR 100% 5.625 7.875 N FCRLB n/a
4 TRCN0000147826 GATGTGAATTTAGTCACCCTT pLKO.1 1770 3UTR 100% 2.640 3.696 N FCRLB n/a
5 TRCN0000438030 AGCCTTGGCTCCTGGTAATAG pLKO_005 1149 CDS 100% 13.200 9.240 N FCRLB n/a
6 TRCN0000430261 CATCAGCACTCTCTGGTATTT pLKO_005 402 CDS 100% 13.200 9.240 N FCRLB n/a
7 TRCN0000147358 GCGAATTTCTTTCAAAGCCAT pLKO.1 1576 3UTR 100% 2.640 1.848 N FCRLB n/a
8 TRCN0000147701 GCAAGAAGTAGAAACCTGTTA pLKO.1 1724 3UTR 100% 4.950 2.970 N FCRLB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001002901.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.