Transcript: Human NM_001003406.2

Homo sapiens calcium voltage-gated channel subunit alpha1 I (CACNA1I), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
CACNA1I (8911)
Length:
9897
CDS:
1..6567

Additional Resources:

NCBI RefSeq record:
NM_001003406.2
NBCI Gene record:
CACNA1I (8911)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001003406.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044168 CGCAAGATGATCGACGTCTAT pLKO.1 3286 CDS 100% 4.950 6.930 N CACNA1I n/a
2 TRCN0000044172 CAGCGTCTCTTTAATCATCAA pLKO.1 5307 CDS 100% 4.950 3.960 N CACNA1I n/a
3 TRCN0000421596 ACTTTGACAACATCGGTTATG pLKO_005 1016 CDS 100% 10.800 7.560 N CACNA1I n/a
4 TRCN0000423870 AGGACGACGTCTACGACTTTG pLKO_005 890 CDS 100% 10.800 7.560 N CACNA1I n/a
5 TRCN0000429795 GCCCTACTATGCCACCTATTG pLKO_005 4296 CDS 100% 10.800 7.560 N CACNA1I n/a
6 TRCN0000044170 CTGGAGGAGATCGAGATCAAT pLKO.1 4597 CDS 100% 5.625 3.938 N CACNA1I n/a
7 TRCN0000044169 GAGGAGAACTTCACCATACAA pLKO.1 724 CDS 100% 5.625 3.938 N CACNA1I n/a
8 TRCN0000044171 GTGGTTTGAATGTGTCAGCAT pLKO.1 237 CDS 100% 2.640 1.848 N CACNA1I n/a
9 TRCN0000044238 GCCATCAACTTTGACAACATT pLKO.1 1009 CDS 100% 5.625 2.813 Y CACNA1G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001003406.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.