Transcript: Human NM_001003665.4

Homo sapiens stum, mechanosensory transduction mediator homolog (STUM), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
STUM (375057)
Length:
7757
CDS:
142..567

Additional Resources:

NCBI RefSeq record:
NM_001003665.4
NBCI Gene record:
STUM (375057)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001003665.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159831 GCTGATTTACTCCAAATAGTT pLKO.1 3123 3UTR 100% 5.625 3.938 N STUM n/a
2 TRCN0000166797 CCTGTTTGGAAGCCTCTGTAT pLKO.1 2388 3UTR 100% 4.950 3.465 N STUM n/a
3 TRCN0000165468 GCTGGATCATGAGCATCTTCT pLKO.1 476 CDS 100% 4.950 3.465 N STUM n/a
4 TRCN0000162235 CCACTAAGTAACTTAGGGAAA pLKO.1 1610 3UTR 100% 4.050 2.835 N STUM n/a
5 TRCN0000165967 GCAGAGAAAGTCAGAGGCAAT pLKO.1 3398 3UTR 100% 4.050 2.835 N STUM n/a
6 TRCN0000165595 GCGGAGACTGTTGATTTGGAT pLKO.1 3535 3UTR 100% 3.000 2.100 N STUM n/a
7 TRCN0000165681 CATCCAAATCCTCACTGCCAT pLKO.1 444 CDS 100% 2.640 1.848 N STUM n/a
8 TRCN0000376253 GGCATGGACATGGTCATCCTT pLKO_005 499 CDS 100% 3.000 1.800 N Stum n/a
9 TRCN0000376188 CAACACTTTCGTGCCGGGATT pLKO_005 321 CDS 100% 4.050 2.835 N Stum n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001003665.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.