Transcript: Human NM_001003715.4

Homo sapiens RecQ like helicase 5 (RECQL5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
RECQL5 (9400)
Length:
2382
CDS:
126..1433

Additional Resources:

NCBI RefSeq record:
NM_001003715.4
NBCI Gene record:
RECQL5 (9400)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001003715.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236026 TTGTCGCCCATTGGAATATTG pLKO_005 1114 CDS 100% 13.200 18.480 N RECQL5 n/a
2 TRCN0000051415 CCCTAAAGGTACGAGTAAGTT pLKO.1 400 CDS 100% 5.625 7.875 N RECQL5 n/a
3 TRCN0000236024 TCAGACTTAGAGGTGAATAAA pLKO_005 1545 3UTR 100% 15.000 10.500 N RECQL5 n/a
4 TRCN0000236028 TGCGACCATGGCTGTAGTAAA pLKO_005 233 CDS 100% 13.200 9.240 N RECQL5 n/a
5 TRCN0000236025 CTGTAATTGTTGCAACCATTA pLKO_005 1057 CDS 100% 10.800 7.560 N RECQL5 n/a
6 TRCN0000236027 GTACGCTGAAGAAGGTCTTTG pLKO_005 178 CDS 100% 10.800 7.560 N RECQL5 n/a
7 TRCN0000051417 GCCACTATCATGGCCTTTGAT pLKO.1 1305 CDS 100% 5.625 3.938 N RECQL5 n/a
8 TRCN0000051414 CGTCTCTATTACTCCAGGAAT pLKO.1 1203 CDS 100% 4.950 3.465 N RECQL5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001003715.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.