Transcript: Human NM_001004060.1

Homo sapiens NODAL modulator 2 (NOMO2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
NOMO2 (283820)
Length:
3986
CDS:
73..3876

Additional Resources:

NCBI RefSeq record:
NM_001004060.1
NBCI Gene record:
NOMO2 (283820)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142132 GCTCATCGAGATAAAGCTGTA pLKO.1 228 CDS 100% 4.050 2.430 N NOMO2 n/a
2 TRCN0000415144 ACTGTTACACCGTCATCTAAA pLKO_005 2362 CDS 100% 13.200 6.600 Y NOMO2 n/a
3 TRCN0000127484 CCAGTCCCTGTTCTTCCATTT pLKO.1 3351 CDS 100% 10.800 5.400 Y NOMO3 n/a
4 TRCN0000421479 GACACGTCTTCACCTAGTATC pLKO_005 2026 CDS 100% 10.800 5.400 Y NOMO2 n/a
5 TRCN0000142616 GATGGCTCGTTCTCTTTCTAT pLKO.1 898 CDS 100% 5.625 2.813 Y NOMO2 n/a
6 TRCN0000122198 GCAAAGAGACAAGCCAAGAAA pLKO.1 3700 CDS 100% 5.625 2.813 Y NOMO1 n/a
7 TRCN0000140189 GTGGAGCATGACAGCTTGAAA pLKO.1 1009 CDS 100% 5.625 2.813 Y NOMO2 n/a
8 TRCN0000141089 CCAGAAGATGCAAAGAGACAA pLKO.1 3691 CDS 100% 4.950 2.475 Y NOMO2 n/a
9 TRCN0000143948 CCATAAACACATCACCTTGAT pLKO.1 3483 CDS 100% 4.950 2.475 Y NOMO2 n/a
10 TRCN0000141010 CCTCATAGTTGCTGGCTACAA pLKO.1 705 CDS 100% 4.950 2.475 Y NOMO1 n/a
11 TRCN0000128202 CCTTCTCGTATGATTTCTCTT pLKO.1 2315 CDS 100% 4.950 2.475 Y NOMO3 n/a
12 TRCN0000130587 CGAACCGCTTACAGTTGCTAT pLKO.1 2944 CDS 100% 4.950 2.475 Y NOMO3 n/a
13 TRCN0000142409 GACTACATCTTGCCTCAAGTT pLKO.1 3442 CDS 100% 4.950 2.475 Y NOMO2 n/a
14 TRCN0000142378 GATGGATGTCACTGTGACTAT pLKO.1 2103 CDS 100% 4.950 2.475 Y NOMO2 n/a
15 TRCN0000142100 GCAAAGATCCAGTCCACAGTT pLKO.1 544 CDS 100% 4.950 2.475 Y NOMO1 n/a
16 TRCN0000140893 GCAGGAGATGGTAGATGAGTT pLKO.1 2286 CDS 100% 4.950 2.475 Y NOMO2 n/a
17 TRCN0000140172 GCAGGCGTAAGCTTTGAGATA pLKO.1 2698 CDS 100% 4.950 2.475 Y NOMO2 n/a
18 TRCN0000142441 GTCGAGATTGTCATCAGTGAA pLKO.1 2512 CDS 100% 4.950 2.475 Y NOMO2 n/a
19 TRCN0000140619 GTGCGTGTAACCAACTCCAAT pLKO.1 667 CDS 100% 4.950 2.475 Y NOMO2 n/a
20 TRCN0000130164 CAAACCCATGATGAAGGAGTT pLKO.1 2850 CDS 100% 4.050 2.025 Y NOMO3 n/a
21 TRCN0000139590 CCTTCCTACGTTATGGGTCAA pLKO.1 3279 CDS 100% 4.050 2.025 Y NOMO2 n/a
22 TRCN0000141855 GACTTACAAAGTGCAGGTGAT pLKO.1 1452 CDS 100% 4.050 2.025 Y NOMO2 n/a
23 TRCN0000142272 GCCTGGAGATTATGAAATCCT pLKO.1 603 CDS 100% 3.000 1.500 Y NOMO2 n/a
24 TRCN0000139791 CCAGAACCTGAAGATCACCAT pLKO.1 2913 CDS 100% 2.640 1.320 Y NOMO2 n/a
25 TRCN0000143133 CTACTTTGAAACGGTCACCAT pLKO.1 1224 CDS 100% 2.640 1.320 Y NOMO1 n/a
26 TRCN0000141757 GCAAGTTCAGATTACGTGGAT pLKO.1 3074 CDS 100% 2.640 1.320 Y NOMO2 n/a
27 TRCN0000144174 CGTCTTCACCTAGTATCTTTA pLKO.1 2030 CDS 100% 13.200 6.600 Y NOMO1 n/a
28 TRCN0000141214 CGGTTTGAGCAAGCGTTCTAT pLKO.1 1999 CDS 100% 5.625 2.813 Y NOMO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13680 pDONR223 100% 52.3% 52.3% None 1_1677del;3666_3801delinsG n/a
2 ccsbBroad304_13680 pLX_304 0% 52.3% 52.3% V5 1_1677del;3666_3801delinsG n/a
Download CSV