Transcript: Human NM_001004352.2

Homo sapiens putative deoxyuridine 5'-triphosphate nucleotidohydrolase-like protein FLJ16323 (LOC100506422), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
LOC100506422 (100506422)
Length:
2320
CDS:
342..767

Additional Resources:

NCBI RefSeq record:
NM_001004352.2
NBCI Gene record:
LOC100506422 (100506422)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004352.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050724 CGACGACGATAATTCCATTAA pLKO.1 400 CDS 100% 13.200 18.480 N LOC100506422 n/a
2 TRCN0000050723 GCCTAATTTCTTCGCATAGTT pLKO.1 1884 3UTR 100% 5.625 7.875 N LOC100506422 n/a
3 TRCN0000050727 GCTGAGAGTCTTGAACACCAA pLKO.1 615 CDS 100% 2.640 2.112 N LOC100506422 n/a
4 TRCN0000050725 CCAAGTGCAAAGCCATCTCAA pLKO.1 632 CDS 100% 4.950 3.465 N LOC100506422 n/a
5 TRCN0000050726 CCCAGAGTATCAAGATGAAAT pLKO.1 518 CDS 100% 13.200 7.920 N LOC100506422 n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 344 CDS 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004352.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.