Transcript: Human NM_001005209.3

Homo sapiens transmembrane protein 198 (TMEM198), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
TMEM198 (130612)
Length:
2213
CDS:
390..1472

Additional Resources:

NCBI RefSeq record:
NM_001005209.3
NBCI Gene record:
TMEM198 (130612)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001005209.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438235 CAGATGCGGACTATGAGTATG pLKO_005 1402 CDS 100% 10.800 15.120 N TMEM198 n/a
2 TRCN0000432582 CCAGTGCGGGTATAGCCATAT pLKO_005 1458 CDS 100% 10.800 15.120 N TMEM198 n/a
3 TRCN0000250582 TGCCCATCAAACGCTTCAATG pLKO_005 1297 CDS 100% 10.800 15.120 N Tmem198 n/a
4 TRCN0000439916 TGCCCATCAAACGCTTCAATG pLKO_005 1297 CDS 100% 10.800 15.120 N TMEM198 n/a
5 TRCN0000436015 GTTTGGCTCGGTGGTCATCTT pLKO_005 599 CDS 100% 4.950 6.930 N TMEM198 n/a
6 TRCN0000166455 CGTCTACTGCTTCTTCGGTTA pLKO.1 539 CDS 100% 4.050 5.670 N TMEM198 n/a
7 TRCN0000165498 GCTGTTTGTTTGGAGTCGTCT pLKO.1 523 CDS 100% 2.640 3.696 N TMEM198 n/a
8 TRCN0000166564 CAGGAAGATCGCAAGGAGAAA pLKO.1 1182 CDS 100% 4.950 3.465 N TMEM198 n/a
9 TRCN0000162931 GATTTCTGACTGGTAGGGTTT pLKO.1 1796 3UTR 100% 4.050 2.835 N TMEM198 n/a
10 TRCN0000164515 CATGTGCTGTTTGTTTGGAGT pLKO.1 518 CDS 100% 2.640 1.848 N TMEM198 n/a
11 TRCN0000166279 CGTGTGTCTGTGTGTATGTGT pLKO.1 1730 3UTR 100% 3.000 1.800 N TMEM198 n/a
12 TRCN0000250581 GAGTCGTCTACTGCTTCTTTG pLKO_005 535 CDS 100% 10.800 8.640 N Tmem198 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005209.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.