Transcript: Human NM_001005212.4

Homo sapiens olfactory receptor family 9 subfamily Q member 1 (OR9Q1), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
OR9Q1 (219956)
Length:
2488
CDS:
317..1249

Additional Resources:

NCBI RefSeq record:
NM_001005212.4
NBCI Gene record:
OR9Q1 (219956)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001005212.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000584656 GGACGTCTGCTACTCATCTAT pLKO_005 523 CDS 100% 5.625 7.875 N OR9Q1 n/a
2 TRCN0000584963 ATCGGGTAGTGTCTGTGCTTT pLKO_005 1125 CDS 100% 4.950 6.930 N OR9Q1 n/a
3 TRCN0000584680 CTTACGTTGCTGGTCTCATCA pLKO_005 759 CDS 100% 4.950 6.930 N OR9Q1 n/a
4 TRCN0000584071 TATGTATCTCATCACCGTATT pLKO_005 415 CDS 100% 10.800 8.640 N OR9Q1 n/a
5 TRCN0000584361 CATGTACTTGAGAGGTAACTC pLKO_005 1084 CDS 100% 4.950 3.960 N OR9Q1 n/a
6 TRCN0000583880 ATAGCATGCTCAATGTTTAAA pLKO_005 1321 3UTR 100% 15.000 10.500 N OR9Q1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005212.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09852 pDONR223 100% 99.8% 100% None 348C>G n/a
2 ccsbBroad304_09852 pLX_304 0% 99.8% 100% V5 348C>G n/a
3 TRCN0000476498 CTATTTTAGCCGGCAGAGTGCCGA pLX_317 39% 99.8% 100% V5 348C>G n/a
Download CSV