Transcript: Mouse NM_001005248.2

Mus musculus HPS5, biogenesis of lysosomal organelles complex 2 subunit 2 (Hps5), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Hps5 (246694)
Length:
4804
CDS:
479..3859

Additional Resources:

NCBI RefSeq record:
NM_001005248.2
NBCI Gene record:
Hps5 (246694)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001005248.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381619 GCATAGCTGTGTCTCGGAAAT pLKO_005 594 CDS 100% 10.800 15.120 N Hps5 n/a
2 TRCN0000382408 AGTCCCTTGTTGATTGCATTT pLKO_005 3002 CDS 100% 10.800 8.640 N Hps5 n/a
3 TRCN0000202429 GCTCAGTTCTTGGCCTATCTA pLKO.1 3131 CDS 100% 5.625 4.500 N Hps5 n/a
4 TRCN0000380649 TGTAGTTGTTTGGGAATTAAA pLKO_005 772 CDS 100% 15.000 10.500 N Hps5 n/a
5 TRCN0000189637 CGTGTCTCTTCAGGCTGTTAA pLKO.1 2086 CDS 100% 13.200 9.240 N Hps5 n/a
6 TRCN0000192959 GCCTCCTGAATGTTAGAATTA pLKO.1 4575 3UTR 100% 13.200 9.240 N Hps5 n/a
7 TRCN0000381324 CAGTCAGTCCGACGAAGATTC pLKO_005 1858 CDS 100% 10.800 7.560 N Hps5 n/a
8 TRCN0000190715 GCTTTGGTACAGGAAGACATA pLKO.1 4149 3UTR 100% 4.950 3.465 N Hps5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005248.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.