Transcript: Human NM_001005326.1

Homo sapiens olfactory receptor family 4 subfamily F member 6 (OR4F6), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
OR4F6 (390648)
Length:
939
CDS:
1..939

Additional Resources:

NCBI RefSeq record:
NM_001005326.1
NBCI Gene record:
OR4F6 (390648)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001005326.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000186229 CTCGATTTATCAAACTGGCTT pLKO.1 545 CDS 100% 2.640 2.112 N OR4F6 n/a
2 TRCN0000202760 CCACATCACATCTTGATAAAT pLKO.1 788 CDS 100% 15.000 10.500 N OR4F6 n/a
3 TRCN0000185595 CAACCTTTCCATCATCAATTT pLKO.1 192 CDS 100% 13.200 9.240 N OR4F6 n/a
4 TRCN0000187662 GCCAACCTTTCCATCATCAAT pLKO.1 190 CDS 100% 5.625 3.938 N OR4F6 n/a
5 TRCN0000203211 GATTTATTTCTCTGGCTTCTT pLKO.1 611 CDS 100% 4.950 3.465 N OR4F6 n/a
6 TRCN0000204355 CCTGATGGGAAATCTCCTCAT pLKO.1 114 CDS 100% 4.050 2.835 N OR4F6 n/a
7 TRCN0000204832 GCTCATGTCATTGTGGTGGTT pLKO.1 724 CDS 100% 2.640 1.848 N OR4F6 n/a
8 TRCN0000202738 CCAAGATGATTTATGACCTTT pLKO.1 236 CDS 100% 4.950 2.475 Y OR4F6 n/a
9 TRCN0000188652 GCCATATGTAAGCCTCTCCAT pLKO.1 373 CDS 100% 0.000 0.000 N Olfr1307 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005326.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.