Transcript: Human NM_001005366.2

Homo sapiens lysine demethylase 2B (KDM2B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
KDM2B (84678)
Length:
5012
CDS:
195..3992

Additional Resources:

NCBI RefSeq record:
NM_001005366.2
NBCI Gene record:
KDM2B (84678)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001005366.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238779 GATGAGTGAGCCGACACTTTC pLKO_005 3984 CDS 100% 10.800 15.120 N KDM2B n/a
2 TRCN0000118439 GAGATGAGCATGTCCCAGTTT pLKO.1 549 CDS 100% 4.950 6.930 N KDM2B n/a
3 TRCN0000122422 GCTGCACAATTTGGCGCTGTA pLKO.1 902 CDS 100% 4.050 5.670 N KDM2B n/a
4 TRCN0000118441 GACTGCAATAAGGTCACTGAT pLKO.1 3816 CDS 100% 4.950 3.960 N KDM2B n/a
5 TRCN0000234588 CCTGAGGAAGAAGCGGAAATA pLKO_005 2498 CDS 100% 13.200 9.240 N KDM2B n/a
6 TRCN0000234590 GAGGGTGGACTTCGGAGAAAT pLKO_005 4089 3UTR 100% 13.200 9.240 N KDM2B n/a
7 TRCN0000234589 CTGAACCACTGCAAGTCTATC pLKO_005 3306 CDS 100% 10.800 7.560 N KDM2B n/a
8 TRCN0000118440 GATGAGCGTGAAAGGTTGTTT pLKO.1 794 CDS 100% 5.625 3.938 N KDM2B n/a
9 TRCN0000122763 CCACTTCTGCAAGGACATGAA pLKO.1 1982 CDS 100% 4.950 3.465 N KDM2B n/a
10 TRCN0000118437 CGGCCTTTACAAGAAGACATT pLKO.1 4056 3UTR 100% 4.950 3.465 N KDM2B n/a
11 TRCN0000118438 CCTTCTTCAAACGCTGTGGAA pLKO.1 3847 CDS 100% 2.640 1.848 N KDM2B n/a
12 TRCN0000234587 ATGAGCGTGAAAGGTTGTTTC pLKO_005 795 CDS 100% 10.800 6.480 N KDM2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005366.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.