Transcript: Human NM_001005386.2

Homo sapiens actin related protein 2 (ACTR2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
ACTR2 (10097)
Length:
3944
CDS:
216..1415

Additional Resources:

NCBI RefSeq record:
NM_001005386.2
NBCI Gene record:
ACTR2 (10097)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001005386.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381758 ACGGTTGGAACGAGAACTTAA pLKO_005 1175 CDS 100% 13.200 18.480 N ACTR2 n/a
2 TRCN0000380936 CACCTGTGGGACTACACATTT pLKO_005 489 CDS 100% 13.200 18.480 N ACTR2 n/a
3 TRCN0000296694 TGCTGCTAGTCGTAGTCTTTA pLKO_005 1723 3UTR 100% 13.200 18.480 N ACTR2 n/a
4 TRCN0000379957 TTGGTGTGACTGTTCGATAAA pLKO_005 1396 CDS 100% 13.200 18.480 N ACTR2 n/a
5 TRCN0000113863 CCTCCTATGAACCCAACCAAA pLKO.1 564 CDS 100% 4.950 6.930 N ACTR2 n/a
6 TRCN0000382142 ACTCACATTTGCCCAGTATAT pLKO_005 720 CDS 100% 13.200 9.240 N ACTR2 n/a
7 TRCN0000308278 GCTGAACCCTTTAGGGCATTT pLKO_005 1848 3UTR 100% 10.800 7.560 N ACTR2 n/a
8 TRCN0000113864 CCACAGTATTAGTTGAATCTT pLKO.1 940 CDS 100% 5.625 3.938 N ACTR2 n/a
9 TRCN0000290833 CCACAGTATTAGTTGAATCTT pLKO_005 940 CDS 100% 5.625 3.938 N ACTR2 n/a
10 TRCN0000113861 CCTGTGAACTTCTTAGGGAAA pLKO.1 1928 3UTR 100% 4.050 2.835 N ACTR2 n/a
11 TRCN0000290905 CCTGTGAACTTCTTAGGGAAA pLKO_005 1928 3UTR 100% 4.050 2.835 N ACTR2 n/a
12 TRCN0000113865 GCAGGCTCTAACTTTCCAGAA pLKO.1 282 CDS 100% 4.050 2.835 N ACTR2 n/a
13 TRCN0000290834 GCAGGCTCTAACTTTCCAGAA pLKO_005 282 CDS 100% 4.050 2.835 N ACTR2 n/a
14 TRCN0000113862 TGCCCAGTATATGAAGGCTTT pLKO.1 729 CDS 100% 4.050 2.835 N ACTR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005386.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.