Transcript: Human NM_001007214.1

Homo sapiens calcyclin binding protein (CACYBP), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
CACYBP (27101)
Length:
2875
CDS:
370..927

Additional Resources:

NCBI RefSeq record:
NM_001007214.1
NBCI Gene record:
CACYBP (27101)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001007214.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125175 CGATGATATGAAGCGAACCAT pLKO.1 849 CDS 100% 3.000 4.200 N Cacybp n/a
2 TRCN0000148456 CGATGATATGAAGCGAACCAT pLKO.1 849 CDS 100% 3.000 4.200 N CACYBP n/a
3 TRCN0000363649 CGATGATATGAAGCGAACCAT pLKO_005 849 CDS 100% 3.000 4.200 N Cacybp n/a
4 TRCN0000363650 CGATGATATGAAGCGAACCAT pLKO_005 849 CDS 100% 3.000 4.200 N CACYBP n/a
5 TRCN0000130068 GAGTTACTCCATGATTGTGAA pLKO.1 609 CDS 100% 4.950 3.960 N CACYBP n/a
6 TRCN0000292263 GAGTTACTCCATGATTGTGAA pLKO_005 609 CDS 100% 4.950 3.960 N CACYBP n/a
7 TRCN0000131203 GATTACCTGACCCAGGTTGAA pLKO.1 730 CDS 100% 4.950 3.960 N CACYBP n/a
8 TRCN0000292205 GATTACCTGACCCAGGTTGAA pLKO_005 730 CDS 100% 4.950 3.960 N CACYBP n/a
9 TRCN0000129434 GCCAAAGGAGACACGGAATTT pLKO.1 904 CDS 100% 13.200 9.240 N CACYBP n/a
10 TRCN0000146815 CAAGAACAAGATGCAACAGAA pLKO.1 360 5UTR 100% 4.950 3.465 N CACYBP n/a
11 TRCN0000292260 CAAGAACAAGATGCAACAGAA pLKO_005 360 5UTR 100% 4.950 3.465 N CACYBP n/a
12 TRCN0000125178 CAGTCAGATAAGTTTGTGAAA pLKO.1 484 CDS 100% 4.950 3.465 N Cacybp n/a
13 TRCN0000312018 CAGTCAGATAAGTTTGTGAAA pLKO_005 484 CDS 100% 4.950 3.465 N Cacybp n/a
14 TRCN0000127886 CATCAAGTTCCCACTGAGAAT pLKO.1 529 CDS 100% 4.950 3.465 N CACYBP n/a
15 TRCN0000292204 CATCAAGTTCCCACTGAGAAT pLKO_005 529 CDS 100% 4.950 3.465 N CACYBP n/a
16 TRCN0000147312 GCAACAGAAATCACAGAAGAA pLKO.1 372 CDS 100% 4.950 3.465 N CACYBP n/a
17 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 2766 3UTR 100% 4.950 2.475 Y ORAI2 n/a
18 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 2728 3UTR 100% 4.050 2.025 Y P3H4 n/a
19 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 2728 3UTR 100% 4.050 2.025 Y ORAI2 n/a
20 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 2728 3UTR 100% 4.050 2.025 Y P3H4 n/a
21 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 2763 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001007214.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.