Transcript: Human NM_001007237.3

Homo sapiens immunoglobulin superfamily member 3 (IGSF3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
IGSF3 (3321)
Length:
7235
CDS:
747..4331

Additional Resources:

NCBI RefSeq record:
NM_001007237.3
NBCI Gene record:
IGSF3 (3321)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001007237.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146433 CGCCTTTGAATACGGTACTTA pLKO.1 2957 CDS 100% 5.625 7.875 N IGSF3 n/a
2 TRCN0000420647 GGTATTCCCTGAGGACTAAAG pLKO_005 3715 CDS 100% 10.800 8.640 N IGSF3 n/a
3 TRCN0000181052 CGCAGCAATATCATGTGGCTA pLKO.1 2115 CDS 100% 2.640 2.112 N IGSF3 n/a
4 TRCN0000416863 CACATCTACTCACAGATTTAT pLKO_005 4605 3UTR 100% 15.000 10.500 N IGSF3 n/a
5 TRCN0000424288 GATGTTACAGGGCTTCTTATT pLKO_005 4642 3UTR 100% 13.200 9.240 N IGSF3 n/a
6 TRCN0000146262 CAGCACTGATAAGCAATACTT pLKO.1 1115 CDS 100% 5.625 3.938 N IGSF3 n/a
7 TRCN0000432525 TTCGTCTTCTTCTACCCTTTC pLKO_005 4128 CDS 100% 6.000 3.600 N IGSF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001007237.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.