Transcript: Human NM_001008273.1

Homo sapiens transgelin 3 (TAGLN3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
TAGLN3 (29114)
Length:
1214
CDS:
264..863

Additional Resources:

NCBI RefSeq record:
NM_001008273.1
NBCI Gene record:
TAGLN3 (29114)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001008273.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423879 TGCAAGCTGATAAATAGTTTA pLKO_005 450 CDS 100% 13.200 18.480 N TAGLN3 n/a
2 TRCN0000442605 TCGCCAGGGACAGAACGTAAT pLKO_005 764 CDS 100% 10.800 8.640 N TAGLN3 n/a
3 TRCN0000148722 CCACCTCCTGTTCATTTAGAA pLKO.1 1031 3UTR 100% 5.625 4.500 N TAGLN3 n/a
4 TRCN0000445559 GATGCCCAGGCAGATCATGTA pLKO_005 842 CDS 100% 4.950 3.465 N TAGLN3 n/a
5 TRCN0000180877 GTTGCAGTCACCAAGGATGAT pLKO.1 666 CDS 100% 4.950 3.465 N TAGLN3 n/a
6 TRCN0000146486 CTCAGAGTCAAAGATGGCTTT pLKO.1 503 CDS 100% 4.050 2.835 N TAGLN3 n/a
7 TRCN0000180816 GAGCAAATCTCCCAGTTCCTA pLKO.1 534 CDS 100% 3.000 2.100 N TAGLN3 n/a
8 TRCN0000149695 GAGAAGATCGAGCAGAAGTAT pLKO.1 309 CDS 100% 5.625 3.375 N TAGLN3 n/a
9 TRCN0000108787 CCATCCTGGTTTCACAGGAAA pLKO.1 705 CDS 100% 0.495 0.297 N Tagln3 n/a
10 TRCN0000108789 CCCAGCAGAATCGGAGAGGAT pLKO.1 727 CDS 100% 0.880 0.616 N Tagln3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001008273.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.