Transcript: Human NM_001008778.2

Homo sapiens speedy/RINGO cell cycle regulator family member C (SPDYC), mRNA.

Source:
NCBI, updated 2019-09-12
Taxon:
Homo sapiens (human)
Gene:
SPDYC (387778)
Length:
991
CDS:
83..964

Additional Resources:

NCBI RefSeq record:
NM_001008778.2
NBCI Gene record:
SPDYC (387778)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001008778.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430655 CTGCACCAGAGGGATAAGCTT pLKO_005 527 CDS 100% 3.000 4.200 N SPDYC n/a
2 TRCN0000220000 ACCTGAAGCTCAGCGAGTATA pLKO.1 381 CDS 100% 13.200 9.240 N SPDYC n/a
3 TRCN0000166976 CCAGATTTCAGATAAGTATCT pLKO.1 325 CDS 100% 4.950 3.465 N SPDYC n/a
4 TRCN0000167959 CCTGCTTCCAGATTTCAGATA pLKO.1 318 CDS 100% 4.950 3.465 N SPDYC n/a
5 TRCN0000446005 TCTGACCTCTGAATGTCATCG pLKO_005 799 CDS 100% 4.050 2.835 N SPDYC n/a
6 TRCN0000444528 AGATTGGTGTTTACGAGTGGG pLKO_005 499 CDS 100% 2.160 1.512 N SPDYC n/a
7 TRCN0000220001 CTGCAGCAGCCACTTGCTTAA pLKO.1 754 CDS 100% 10.800 6.480 N SPDYC n/a
8 TRCN0000166950 GATTTCAGATAAGTATCTCCT pLKO.1 328 CDS 100% 2.640 1.584 N SPDYC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001008778.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05568 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05568 pLX_304 0% 100% 100% V5 n/a
Download CSV