Transcript: Mouse NM_001009947.3

Mus musculus dedicator of cytokinesis 11 (Dock11), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Dock11 (75974)
Length:
6665
CDS:
100..6321

Additional Resources:

NCBI RefSeq record:
NM_001009947.3
NBCI Gene record:
Dock11 (75974)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001009947.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265580 ACTAAATGAGCGGCTAATTAA pLKO_005 6096 CDS 100% 15.000 21.000 N Dock11 n/a
2 TRCN0000369611 ACTAAATGAGCGGCTAATTAA pLKO_005 6096 CDS 100% 15.000 21.000 N DOCK11 n/a
3 TRCN0000265567 CTGTGCAACTGTTAGCATTTA pLKO_005 6376 3UTR 100% 13.200 18.480 N Dock11 n/a
4 TRCN0000265583 CACTTATGTGAAGCCGTATTT pLKO_005 5604 CDS 100% 13.200 10.560 N Dock11 n/a
5 TRCN0000217343 GCAGATTTCCTAGCCATAAAT pLKO.1 2944 CDS 100% 15.000 10.500 N Dock11 n/a
6 TRCN0000265581 GCAGATTTCCTAGCCATAAAT pLKO_005 2944 CDS 100% 15.000 10.500 N Dock11 n/a
7 TRCN0000265574 TTCATCAACCTCGCCTTATTT pLKO_005 1288 CDS 100% 15.000 10.500 N Dock11 n/a
8 TRCN0000217207 CAACTTCCTGATGGTTCATAT pLKO.1 688 CDS 100% 13.200 9.240 N Dock11 n/a
9 TRCN0000200778 GACAGTTTAGTGCAAGAGAAA pLKO.1 925 CDS 100% 4.950 3.465 N Dock11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001009947.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.