Transcript: Mouse NM_001009952.2

Mus musculus secretoglobin, family 2B, member 20 (Scgb2b20), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Scgb2b20 (494519)
Length:
520
CDS:
20..358

Additional Resources:

NCBI RefSeq record:
NM_001009952.2
NBCI Gene record:
Scgb2b20 (494519)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001009952.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254875 TACTATGGTCTTGACAATATA pLKO_005 296 CDS 100% 15.000 7.500 Y Scgb2b20 n/a
2 TRCN0000254878 AGTGAGGAAAGAATAAGAAAT pLKO_005 218 CDS 100% 13.200 6.600 Y Scgb2b20 n/a
3 TRCN0000191695 CATACTATGGTCTTGACAATA pLKO.1 294 CDS 100% 13.200 6.600 Y Scgb2b20 n/a
4 TRCN0000254877 GACTATATTTCCAAGCTATTA pLKO_005 329 CDS 100% 13.200 6.600 Y Scgb2b20 n/a
5 TRCN0000267485 GAAGTAGGGTGTGGTTGTATC pLKO_005 129 CDS 100% 10.800 5.400 Y Scgb2b20 n/a
6 TRCN0000254876 TTCGAAGGCTATGCAAGTGTT pLKO_005 101 CDS 100% 4.950 2.475 Y Scgb2b20 n/a
7 TRCN0000190111 CTCCAGGCATTCAATGCTACT pLKO.1 155 CDS 100% 4.050 2.025 Y Scgb2b20 n/a
8 TRCN0000190136 GCTTCCAGACAACAGAAGCAT pLKO.1 69 CDS 100% 0.300 0.150 Y Scgb2b20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001009952.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.