Transcript: Human NM_001010891.5

Homo sapiens metaxin 3 (MTX3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
MTX3 (345778)
Length:
7842
CDS:
25..771

Additional Resources:

NCBI RefSeq record:
NM_001010891.5
NBCI Gene record:
MTX3 (345778)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001010891.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148308 CAGCAAATCTTATCAAGTCGT pLKO.1 2126 3UTR 100% 2.640 3.696 N MTX3 n/a
2 TRCN0000183217 GCAGATACATTGGCTTATATT pLKO.1 292 CDS 100% 15.000 10.500 N MTX3 n/a
3 TRCN0000148420 CCCTTGAAAGTCAATGTGATA pLKO.1 130 CDS 100% 4.950 3.465 N MTX3 n/a
4 TRCN0000148372 CTGATTATGAACTCTCAGCAA pLKO.1 263 CDS 100% 2.640 1.848 N MTX3 n/a
5 TRCN0000184149 CGTGCAGGAACCCATATGTTA pLKO.1 2144 3UTR 100% 0.000 0.000 N MTX3 n/a
6 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 3590 3UTR 100% 4.950 2.475 Y LOC387873 n/a
7 TRCN0000346664 GAAGTGGAAGCACAGATATAT pLKO_005 514 CDS 100% 15.000 10.500 N Mtx3 n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3627 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3627 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001010891.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14480 pDONR223 100% 61.6% 7.9% None (many diffs) n/a
2 ccsbBroad304_14480 pLX_304 0% 61.6% 7.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV