Transcript: Human NM_001010898.4

Homo sapiens solute carrier family 6 member 17 (SLC6A17), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SLC6A17 (388662)
Length:
6419
CDS:
478..2661

Additional Resources:

NCBI RefSeq record:
NM_001010898.4
NBCI Gene record:
SLC6A17 (388662)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001010898.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038515 CGGGTGGAGCATCTTCTATTT pLKO.1 960 CDS 100% 13.200 9.240 N SLC6A17 n/a
2 TRCN0000038516 GTGGTCGAGAATGCTGAGAAA pLKO.1 1576 CDS 100% 4.950 3.465 N SLC6A17 n/a
3 TRCN0000038517 CAGCTACAATAAGCAGGACAA pLKO.1 1437 CDS 100% 4.050 2.835 N SLC6A17 n/a
4 TRCN0000038518 CCTGGATTTATGGAACCAAGA pLKO.1 2108 CDS 100% 4.050 2.835 N SLC6A17 n/a
5 TRCN0000038514 CGGAAACTACTTTGTCACCAT pLKO.1 2022 CDS 100% 2.640 1.848 N SLC6A17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001010898.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.