Transcript: Human NM_001011645.3

Homo sapiens androgen receptor (AR), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
AR (367)
Length:
10257
CDS:
2308..3474

Additional Resources:

NCBI RefSeq record:
NM_001011645.3
NBCI Gene record:
AR (367)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001011645.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350462 GAGCGTGGACTTTCCGGAAAT pLKO_005 3375 CDS 100% 10.800 15.120 N AR n/a
2 TRCN0000003715 CCTGCTAATCAAGTCACACAT pLKO.1 3351 CDS 100% 4.950 6.930 N AR n/a
3 TRCN0000314658 CCTGCTAATCAAGTCACACAT pLKO_005 3351 CDS 100% 4.950 6.930 N AR n/a
4 TRCN0000314730 GATGTCTTCTGCCTGTTATAA pLKO_005 3521 3UTR 100% 15.000 10.500 N AR n/a
5 TRCN0000003717 CGCGACTACTACAACTTTCCA pLKO.1 1608 5UTR 100% 3.000 2.100 N AR n/a
6 TRCN0000003718 CACCAATGTCAACTCCAGGAT pLKO.1 2976 CDS 100% 2.640 1.848 N AR n/a
7 TRCN0000314657 CACCAATGTCAACTCCAGGAT pLKO_005 2976 CDS 100% 2.640 1.848 N AR n/a
8 TRCN0000003714 CCTTCAGACTTTGCTTCCCAT pLKO.1 3696 3UTR 100% 2.640 1.848 N AR n/a
9 TRCN0000003716 GAAATGTTATGAAGCAGGGAT pLKO.1 2565 CDS 100% 2.640 1.848 N AR n/a
10 TRCN0000314656 GAAATGTTATGAAGCAGGGAT pLKO_005 2565 CDS 100% 2.640 1.848 N AR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001011645.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.