Transcript: Human NM_001011649.3

Homo sapiens CDK5 regulatory subunit associated protein 2 (CDK5RAP2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
CDK5RAP2 (55755)
Length:
5995
CDS:
190..5634

Additional Resources:

NCBI RefSeq record:
NM_001011649.3
NBCI Gene record:
CDK5RAP2 (55755)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001011649.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000323240 AGTGCAGTGAGGCCATAATTA pLKO_005 3602 CDS 100% 15.000 10.500 N CDK5RAP2 n/a
2 TRCN0000323174 CCAAGTGTGGTTCCTATTTAT pLKO_005 5696 3UTR 100% 15.000 10.500 N CDK5RAP2 n/a
3 TRCN0000323172 GCGTTTAGAAGAATCTATTAA pLKO_005 4410 CDS 100% 15.000 10.500 N CDK5RAP2 n/a
4 TRCN0000350811 TCAGGAGTGAAGGCTTAATAA pLKO_005 1742 CDS 100% 15.000 10.500 N CDK5RAP2 n/a
5 TRCN0000350756 ATAGTCTAAAGAGGGATAAAG pLKO_005 1124 CDS 100% 13.200 9.240 N CDK5RAP2 n/a
6 TRCN0000128328 GCAGCAGAGTAATGAGATTAT pLKO.1 2376 CDS 100% 13.200 9.240 N CDK5RAP2 n/a
7 TRCN0000128676 CGCTCTCTGATTATGAAACAT pLKO.1 4262 CDS 100% 5.625 3.938 N CDK5RAP2 n/a
8 TRCN0000147465 CTTGCTGAAATGGACATTCAA pLKO.1 5194 CDS 100% 5.625 3.938 N CDK5RAP2 n/a
9 TRCN0000128955 GCACAATCAAGAGCAAGTGAT pLKO.1 1605 CDS 100% 4.950 3.465 N CDK5RAP2 n/a
10 TRCN0000129226 CGCATCTATTTCCTTGAGGAA pLKO.1 427 CDS 100% 2.640 1.848 N CDK5RAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001011649.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.