Transcript: Mouse NM_001011732.1

Mus musculus X-linked Kx blood group related 7 (Xkr7), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Xkr7 (228787)
Length:
2730
CDS:
164..1906

Additional Resources:

NCBI RefSeq record:
NM_001011732.1
NBCI Gene record:
Xkr7 (228787)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001011732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126413 AGTGTCTACAAGCTCTACTTT pLKO.1 1127 CDS 100% 5.625 3.938 N Xkr7 n/a
2 TRCN0000126409 CCAGGCTAAGTGGGAATAGAT pLKO.1 1986 3UTR 100% 5.625 3.938 N Xkr7 n/a
3 TRCN0000126411 CTGGAGTATGAGACCACAGTA pLKO.1 1883 CDS 100% 4.950 3.465 N Xkr7 n/a
4 TRCN0000126410 GCCTGTCATTCGGATTGACTT pLKO.1 1726 CDS 100% 4.950 3.465 N Xkr7 n/a
5 TRCN0000145149 GCATATTCTTCATGTGTGTCT pLKO.1 1446 CDS 100% 2.640 1.848 N XKR7 n/a
6 TRCN0000126412 GCGCCACTTCTACTGGCAGAT pLKO.1 805 CDS 100% 1.350 0.945 N Xkr7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001011732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.