Transcript: Mouse NM_001011752.1

Mus musculus olfactory receptor 293 (Olfr293), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Olfr293 (257906)
Length:
1011
CDS:
1..1011

Additional Resources:

NCBI RefSeq record:
NM_001011752.1
NBCI Gene record:
Olfr293 (257906)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001011752.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184987 CTATATCATATGCTCGCATAT pLKO.1 656 CDS 100% 0.000 0.000 N Olfr293 n/a
2 TRCN0000186718 GCTATATCATATGCTCGCATA pLKO.1 655 CDS 100% 0.000 0.000 N Olfr293 n/a
3 TRCN0000186344 CCATTGTTCCACCATTCTTAA pLKO.1 851 CDS 100% 13.200 6.600 Y Olfr293 n/a
4 TRCN0000204577 CCGAGTTCATGCTGGAAGATT pLKO.1 41 CDS 100% 5.625 2.813 Y Olfr293 n/a
5 TRCN0000189313 CCTCTCCTCTACCCTATGATT pLKO.1 397 CDS 100% 5.625 2.813 Y Olfr297 n/a
6 TRCN0000188119 CTCAGGAATCTGTCCATCTTA pLKO.1 199 CDS 100% 5.625 2.813 Y Olfr297 n/a
7 TRCN0000202997 CCTATGATTATGAACCATCAA pLKO.1 409 CDS 100% 4.950 2.475 Y Olfr297 n/a
8 TRCN0000187433 GCTTGTATCAACTCTCTCACT pLKO.1 253 CDS 100% 2.640 1.320 Y Olfr293 n/a
9 TRCN0000060371 CCATGTACTTCTTCCTCAGAA pLKO.1 185 CDS 100% 4.950 2.475 Y OR10A2 n/a
10 TRCN0000188492 CCCATGTACTTCTTCCTCACA pLKO.1 184 CDS 100% 2.640 1.320 Y Olfr317 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001011752.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.