Transcript: Mouse NM_001011874.1

Mus musculus X-linked Kx blood group related 4 (Xkr4), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Xkr4 (497097)
Length:
3652
CDS:
151..2094

Additional Resources:

NCBI RefSeq record:
NM_001011874.1
NBCI Gene record:
Xkr4 (497097)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001011874.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183012 CCTCTAATCATTAGGGTATTT pLKO.1 2368 3UTR 100% 13.200 18.480 N Xkr4 n/a
2 TRCN0000183619 GCACACAATATACTTAGGTAT pLKO.1 954 CDS 100% 4.950 6.930 N Xkr4 n/a
3 TRCN0000178977 CGGATTGAAGAATCAGTCATT pLKO.1 1906 CDS 100% 4.950 3.960 N Xkr4 n/a
4 TRCN0000180498 GCTGATGTACTATGCCTTCTT pLKO.1 1659 CDS 100% 4.950 3.465 N Xkr4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001011874.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.