Transcript: Mouse NM_001012273.1

Mus musculus baculoviral IAP repeat-containing 5 (Birc5), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Birc5 (11799)
Length:
3416
CDS:
115..480

Additional Resources:

NCBI RefSeq record:
NM_001012273.1
NBCI Gene record:
Birc5 (11799)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001012273.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054615 CCCGATAGAGGAGCATAGAAA pLKO.1 330 CDS 100% 5.625 7.875 N Birc5 n/a
2 TRCN0000054616 CAAAGACTACCCGTCAGTCAA pLKO.1 2941 3UTR 100% 4.950 6.930 N Birc5 n/a
3 TRCN0000335352 CAAAGACTACCCGTCAGTCAA pLKO_005 2941 3UTR 100% 4.950 6.930 N Birc5 n/a
4 TRCN0000054613 GAAGAACTAACCGTCAGTGAA pLKO.1 394 CDS 100% 4.950 6.930 N Birc5 n/a
5 TRCN0000335351 GAAGAACTAACCGTCAGTGAA pLKO_005 394 CDS 100% 4.950 6.930 N Birc5 n/a
6 TRCN0000054614 CCTACCGAGAACGAGCCTGAT pLKO.1 253 CDS 100% 1.350 1.890 N Birc5 n/a
7 TRCN0000348519 ACCGAGAACGAGCCTGATTTG pLKO_005 256 CDS 100% 10.800 8.640 N Birc5 n/a
8 TRCN0000054617 GCAGCTGTACCTCAAGAACTA pLKO.1 144 CDS 100% 4.950 3.465 N Birc5 n/a
9 TRCN0000348591 TCTATTGTGACGTGGACTTAA pLKO_005 3171 3UTR 100% 13.200 7.920 N Birc5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001012273.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.