Transcript: Mouse NM_001012325.2

Mus musculus zinc finger protein 708 (Zfp708), transcript variant 1, mRNA.

Source:
NCBI, updated 2015-07-31
Taxon:
Mus musculus (mouse)
Gene:
Zfp708 (432769)
Length:
2567
CDS:
143..1768

Additional Resources:

NCBI RefSeq record:
NM_001012325.2
NBCI Gene record:
Zfp708 (432769)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001012325.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096305 CTGTTCCGATTATCTTGTTAA pLKO.1 1123 CDS 100% 13.200 10.560 N Zfp708 n/a
2 TRCN0000096304 CCACAGTTGTTCATTGACAAT pLKO.1 1792 3UTR 100% 4.950 3.465 N Zfp708 n/a
3 TRCN0000096307 CCTTTAGTGTTCACTCAACAT pLKO.1 1452 CDS 100% 4.950 3.465 N Zfp708 n/a
4 TRCN0000096306 TCCCATCTTAAACAACACAAA pLKO.1 1046 CDS 100% 4.950 3.465 N Zfp708 n/a
5 TRCN0000096308 TCCGATTATCTTGTTAAGCAT pLKO.1 1127 CDS 100% 3.000 2.100 N Zfp708 n/a
6 TRCN0000235191 ACTGGAGAGAAACCATATAAA pLKO_005 1076 CDS 100% 15.000 7.500 Y Gm4767 n/a
7 TRCN0000235210 ACTGGAGAGAAACCATATAAA pLKO_005 1076 CDS 100% 15.000 7.500 Y EG666477 n/a
8 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1161 CDS 100% 13.200 6.600 Y Zfp934 n/a
9 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1161 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
10 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1161 CDS 100% 13.200 6.600 Y EG668616 n/a
11 TRCN0000284677 ACAATGTGGTAAAGCCTTTAC pLKO_005 1690 CDS 100% 10.800 5.400 Y Gm14410 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001012325.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.