Transcript: Human NM_001012659.2

Homo sapiens arginine-fifty homeobox (ARGFX), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
ARGFX (503582)
Length:
5047
CDS:
78..1025

Additional Resources:

NCBI RefSeq record:
NM_001012659.2
NBCI Gene record:
ARGFX (503582)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001012659.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148889 CGGAGTCAACAGTAAAGGTTT pLKO.1 430 CDS 100% 4.950 3.465 N ARGFX n/a
2 TRCN0000150051 CCAGACATAATAAGAGGTGTA pLKO.1 2415 3UTR 100% 4.050 2.835 N ARGFX n/a
3 TRCN0000147832 GTACAATCTTCCTGATGAGAA pLKO.1 776 CDS 100% 4.950 2.970 N ARGFX n/a
4 TRCN0000146683 CAATATGGTAGACTTGGGATT pLKO.1 998 CDS 100% 4.050 2.430 N ARGFX n/a
5 TRCN0000149635 GCTTTGTACTCTGATGCCTAT pLKO.1 732 CDS 100% 4.050 2.025 Y ARGFX n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2631 3UTR 100% 13.200 6.600 Y LIAS n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1734 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 3926 3UTR 100% 2.640 1.320 Y LINC01098 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1734 3UTR 100% 5.625 2.813 Y EID2B n/a
10 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3079 3UTR 100% 4.950 2.475 Y ERN2 n/a
11 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3079 3UTR 100% 4.950 2.475 Y P3H4 n/a
12 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3079 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001012659.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.