Transcript: Human NM_001012975.1

Homo sapiens ribonuclease A family member 10 (inactive) (RNASE10), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
RNASE10 (338879)
Length:
651
CDS:
1..651

Additional Resources:

NCBI RefSeq record:
NM_001012975.1
NBCI Gene record:
RNASE10 (338879)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001012975.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373375 AGAGTTGCATAGCCCAGTATG pLKO_005 395 CDS 100% 10.800 8.640 N RNASE10 n/a
2 TRCN0000049811 GAGGATCTAAACACAGTCAAA pLKO.1 427 CDS 100% 4.950 3.960 N RNASE10 n/a
3 TRCN0000373377 AGATAGAGAATGCAATGATAT pLKO_005 345 CDS 100% 13.200 9.240 N RNASE10 n/a
4 TRCN0000373376 AGTGATCAACCGCTCAATGAA pLKO_005 109 CDS 100% 5.625 3.938 N RNASE10 n/a
5 TRCN0000049809 GCTCTCTTTCAGAGCAACAAA pLKO.1 301 CDS 100% 0.563 0.394 N RNASE10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001012975.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05446 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05446 pLX_304 0% 100% 100% V5 n/a
Download CSV