Transcript: Mouse NM_001013375.1

Mus musculus UTP18 small subunit processome component (Utp18), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Utp18 (217109)
Length:
2613
CDS:
110..1768

Additional Resources:

NCBI RefSeq record:
NM_001013375.1
NBCI Gene record:
Utp18 (217109)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001013375.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121496 CAATCGGTTTCGGAAAGATAT pLKO.1 565 CDS 100% 13.200 9.240 N Utp18 n/a
2 TRCN0000346760 CAATCGGTTTCGGAAAGATAT pLKO_005 565 CDS 100% 13.200 9.240 N Utp18 n/a
3 TRCN0000145055 CAGCAAGGTTCTTTATGTCTA pLKO.1 1045 CDS 100% 4.950 3.465 N UTP18 n/a
4 TRCN0000121492 CCAGAAGTTTCCAAGTGTGAT pLKO.1 1822 3UTR 100% 4.950 3.465 N Utp18 n/a
5 TRCN0000346821 CCAGAAGTTTCCAAGTGTGAT pLKO_005 1822 3UTR 100% 4.950 3.465 N Utp18 n/a
6 TRCN0000121494 CCTTTAATCCTACCACAGAAA pLKO.1 1536 CDS 100% 4.950 3.465 N Utp18 n/a
7 TRCN0000121495 GCTGGGAAGTTAATTCCTGTA pLKO.1 1076 CDS 100% 4.050 2.835 N Utp18 n/a
8 TRCN0000346819 GCTGGGAAGTTAATTCCTGTA pLKO_005 1076 CDS 100% 4.050 2.835 N Utp18 n/a
9 TRCN0000121493 GCCCTGATGTATAGGTTGCAT pLKO.1 1730 CDS 100% 3.000 2.100 N Utp18 n/a
10 TRCN0000346820 GCCCTGATGTATAGGTTGCAT pLKO_005 1730 CDS 100% 3.000 2.100 N Utp18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013375.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.