Transcript: Mouse NM_001013387.2

Mus musculus zinc finger protein 182 (Zfp182), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Zfp182 (319535)
Length:
5920
CDS:
157..2040

Additional Resources:

NCBI RefSeq record:
NM_001013387.2
NBCI Gene record:
Zfp182 (319535)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001013387.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095718 GAGGACGCATACAGTAAAGAA pLKO.1 2010 CDS 100% 5.625 7.875 N Zfp182 n/a
2 TRCN0000095714 CCTTGCATTTACAGAAAGTAA pLKO.1 2402 3UTR 100% 5.625 3.938 N Zfp182 n/a
3 TRCN0000095717 CAGACCCAGAAGATGGAGAAA pLKO.1 410 CDS 100% 4.950 3.465 N Zfp182 n/a
4 TRCN0000095716 GAATGCCTTGTGTGCTGGAAA pLKO.1 1786 CDS 100% 4.950 3.465 N Zfp182 n/a
5 TRCN0000095715 GATGCAAGTTAGACTCCCTAA pLKO.1 516 CDS 100% 4.050 2.835 N Zfp182 n/a
6 TRCN0000239829 AGGAGAGAAACCCTATGAATG pLKO_005 1770 CDS 100% 10.800 5.400 Y Gm14393 n/a
7 TRCN0000234230 ACTGGAGAGAAGCCCTATAAA pLKO_005 1936 CDS 100% 15.000 7.500 Y EG666702 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013387.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13984 pDONR223 100% 78.5% 79.8% None (many diffs) n/a
2 ccsbBroad304_13984 pLX_304 0% 78.5% 79.8% V5 (many diffs) n/a
Download CSV