Transcript: Human NM_001013736.2

Homo sapiens family with sequence similarity 47 member C (FAM47C), mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
FAM47C (442444)
Length:
3308
CDS:
53..3160

Additional Resources:

NCBI RefSeq record:
NM_001013736.2
NBCI Gene record:
FAM47C (442444)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001013736.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129077 GCACCAAATTCTCATAGTGCA pLKO.1 2825 CDS 100% 2.640 2.112 N FAM47C n/a
2 TRCN0000128155 CGAAATGGATGAGGTCAAATT pLKO.1 2764 CDS 100% 13.200 9.240 N FAM47C n/a
3 TRCN0000127487 CCTGAGAGTAGCGTATCTCAT pLKO.1 1667 CDS 100% 0.495 0.347 N FAM47C n/a
4 TRCN0000145508 GACTCTGTTAAGACTCCTATT pLKO.1 3077 CDS 100% 10.800 5.400 Y FAM47B n/a
5 TRCN0000128730 CTCCTGAAGATACGCTTGTTT pLKO.1 243 CDS 100% 5.625 2.813 Y FAM47C n/a
6 TRCN0000141172 CAAGCACAATGGAGTGTGTTT pLKO.1 2550 CDS 100% 4.950 2.475 Y FAM47B n/a
7 TRCN0000122728 CCGACATTCTTGACGGTCTTT pLKO.1 2961 CDS 100% 4.950 2.475 Y FAM47B n/a
8 TRCN0000141727 GAATCCATCAGCAGTCTGTTT pLKO.1 2648 CDS 100% 4.950 2.475 Y FAM47B n/a
9 TRCN0000142488 GAGTGTGTTTCTGACTCTCTT pLKO.1 2561 CDS 100% 4.950 2.475 Y FAM47B n/a
10 TRCN0000128456 GCTAAGAAGTGATGAACCTTT pLKO.1 2902 CDS 100% 4.950 2.475 Y FAM47C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013736.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05150 pDONR223 100% 57.2% 49.6% None (many diffs) n/a
2 ccsbBroad304_05150 pLX_304 0% 57.2% 49.6% V5 (many diffs) n/a
Download CSV