Transcript: Mouse NM_001013817.2

Mus musculus Sp140 nuclear body protein (Sp140), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Sp140 (434484)
Length:
2417
CDS:
458..2062

Additional Resources:

NCBI RefSeq record:
NM_001013817.2
NBCI Gene record:
Sp140 (434484)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001013817.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254775 GATGATTACTCTTGGTCATAT pLKO_005 2153 3UTR 100% 13.200 9.240 N Sp140 n/a
2 TRCN0000201712 GCAGCAGCAATGAGTGTTCTT pLKO.1 2112 3UTR 100% 4.950 3.465 N Sp140 n/a
3 TRCN0000347231 GTATTCAGAACTCAGATAAAT pLKO_005 1518 CDS 100% 15.000 9.000 N Sp140 n/a
4 TRCN0000254776 TGAGCCTGCGCTGCCATAATT pLKO_005 1386 CDS 100% 15.000 7.500 Y Sp140 n/a
5 TRCN0000254777 TGGTTCACACCCTCGGAATTT pLKO_005 1325 CDS 100% 13.200 6.600 Y Sp140 n/a
6 TRCN0000347248 GACCCTAAGTTTGGCGAAATG pLKO_005 1964 CDS 100% 10.800 5.400 Y Sp140 n/a
7 TRCN0000178800 CAGAATGAAGAGGAGTCAGAT pLKO.1 506 CDS 100% 4.950 2.475 Y A530032D15Rik n/a
8 TRCN0000191668 GTATGTTCTCTTGAGAGTCTA pLKO.1 1750 CDS 100% 4.950 2.475 Y Sp140 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013817.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.