Transcript: Human NM_001014986.3

Homo sapiens folate hydrolase 1 (FOLH1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
FOLH1 (2346)
Length:
4017
CDS:
194..2353

Additional Resources:

NCBI RefSeq record:
NM_001014986.3
NBCI Gene record:
FOLH1 (2346)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001014986.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006810 CCCAAATAAGACTCATCCCAA pLKO.1 550 CDS 100% 2.640 1.584 N FOLH1 n/a
2 TRCN0000006808 CCCAACTACATCTCAATAATT pLKO.1 566 CDS 100% 15.000 7.500 Y FOLH1 n/a
3 TRCN0000427513 GAGTCATTCCCAGGAATTTAT pLKO_005 2207 CDS 100% 15.000 7.500 Y FOLH1B n/a
4 TRCN0000006809 CCAATGAAGCTACTAACATTA pLKO.1 330 CDS 100% 13.200 6.600 Y FOLH1 n/a
5 TRCN0000414521 CTTTATGAAAGTTGGACTAAA pLKO_005 1670 CDS 100% 13.200 6.600 Y FOLH1B n/a
6 TRCN0000430965 TTCGAGGAGGGATGGTGTTTG pLKO_005 1929 CDS 100% 10.800 5.400 Y FOLH1B n/a
7 TRCN0000118403 CCTGGCTTTACTGGAAACTTT pLKO.1 1184 CDS 100% 5.625 2.813 Y FOLH1B n/a
8 TRCN0000006807 GCACGAACTGAAGACTTCTTT pLKO.1 731 CDS 100% 5.625 2.813 Y FOLH1 n/a
9 TRCN0000118406 GTCGAGATTATGCTGTAGTTT pLKO.1 1983 CDS 100% 5.625 2.813 Y FOLH1B n/a
10 TRCN0000006811 CCACTGTATCACAGTGTCTAT pLKO.1 1841 CDS 100% 0.495 0.248 Y FOLH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001014986.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.