Transcript: Human NM_001018024.3

Homo sapiens C-X9-C motif containing 4 (CMC4), mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
CMC4 (100272147)
Length:
881
CDS:
454..660

Additional Resources:

NCBI RefSeq record:
NM_001018024.3
NBCI Gene record:
CMC4 (100272147)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001018024.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344476 ACACGGAAGTCTGCATCAAAG pLKO_005 637 CDS 100% 10.800 15.120 N CMC4 n/a
2 TRCN0000344419 GTCATCCAAGAACTGCGTAAG pLKO_005 544 CDS 100% 6.000 8.400 N CMC4 n/a
3 TRCN0000353060 CTGTCGTCTGTTCAGGATTTG pLKO_005 593 CDS 100% 10.800 7.560 N CMC4 n/a
4 TRCN0000344417 TGAAGTGCTGCTCCATGTTTC pLKO_005 669 3UTR 100% 10.800 7.560 N CMC4 n/a
5 TRCN0000107149 ACGGAAGTCTGCATCAAAGTA pLKO.1 639 CDS 100% 5.625 3.938 N MTCP1 n/a
6 TRCN0000107145 CCATGTTTCCACCAAATGAAT pLKO.1 681 3UTR 100% 5.625 3.938 N MTCP1 n/a
7 TRCN0000107147 TCGTCTGTTCAGGATTTGAAA pLKO.1 596 CDS 100% 5.625 3.938 N MTCP1 n/a
8 TRCN0000107146 CAAGCCTGTGAGATACAGAAA pLKO.1 481 CDS 100% 4.950 3.465 N MTCP1 n/a
9 TRCN0000107148 TGTCAGGCTGTCATCCAAGAA pLKO.1 535 CDS 100% 4.950 3.465 N MTCP1 n/a
10 TRCN0000344475 CAACAGCTACATGGAATCAAA pLKO_005 513 CDS 100% 5.625 3.375 N CMC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001018024.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05748 pDONR223 100% 100% 100% None n/a
Download CSV