Transcript: Mouse NM_001018087.1

Mus musculus leucine zipper, down-regulated in cancer 1 (Ldoc1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ldoc1 (434784)
Length:
1397
CDS:
105..560

Additional Resources:

NCBI RefSeq record:
NM_001018087.1
NBCI Gene record:
Ldoc1 (434784)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001018087.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184093 CCAGTCTTTACCGACTGGTTA pLKO.1 1050 3UTR 100% 0.495 0.693 N Ldoc1 n/a
2 TRCN0000179521 GTTGATGAGATGAAGCAGTAT pLKO.1 468 CDS 100% 4.950 3.465 N Ldoc1 n/a
3 TRCN0000184587 GCACTTCTGCAATGATGCCAT pLKO.1 344 CDS 100% 2.640 1.848 N Ldoc1 n/a
4 TRCN0000180904 GAGGAAGAAATGGAGGAAGAT pLKO.1 534 CDS 100% 4.950 2.970 N Ldoc1 n/a
5 TRCN0000179671 GATGATGATGAAGAGGAAGAA pLKO.1 522 CDS 100% 4.950 2.475 Y Ldoc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001018087.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.