Transcript: Mouse NM_001024142.1

Mus musculus F-box protein 10 (Fbxo10), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Fbxo10 (269529)
Length:
4655
CDS:
122..2974

Additional Resources:

NCBI RefSeq record:
NM_001024142.1
NBCI Gene record:
Fbxo10 (269529)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001024142.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000342124 ACTTACGCGGTGCGGTGTATA pLKO_005 1496 CDS 100% 13.200 18.480 N Fbxo10 n/a
2 TRCN0000342121 CTCGTGGAGTCCAACAGTATT pLKO_005 2270 CDS 100% 13.200 18.480 N Fbxo10 n/a
3 TRCN0000342123 GTCTGACACTAAGGTACTAAA pLKO_005 2605 CDS 100% 13.200 10.560 N Fbxo10 n/a
4 TRCN0000342183 CTCCGGCACTTAGAGGTTATG pLKO_005 3224 3UTR 100% 10.800 8.640 N Fbxo10 n/a
5 TRCN0000342122 CCGCTACCTGGAGCATCTATT pLKO_005 1286 CDS 100% 13.200 7.920 N Fbxo10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001024142.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11823 pDONR223 100% 44% 47.1% None (many diffs) n/a
2 TRCN0000476677 TAACGCTGTCCAACGACTGAAGGA pLX_317 22.6% 44% 47.1% V5 (many diffs) n/a
Download CSV