Construct: ORF TRCN0000476677
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011675.1_s317c1
- Derived from:
- ccsbBroadEn_11823
- DNA Barcode:
- TAACGCTGTCCAACGACTGAAGGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FBXO10 (26267)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476677
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 26267 | FBXO10 | F-box protein 10 | XM_006716754.4 | 99.9% | 100% | 564C>T |
| 2 | human | 26267 | FBXO10 | F-box protein 10 | NM_012166.3 | 50.2% | 50.3% | 1_1425del;1989C>T |
| 3 | human | 26267 | FBXO10 | F-box protein 10 | XM_017014619.2 | 50.2% | 50.3% | 1_1425del;1989C>T |
| 4 | human | 26267 | FBXO10 | F-box protein 10 | XM_017014618.1 | 47.4% | 47.4% | 1_1599del;2163C>T |
| 5 | human | 26267 | FBXO10 | F-box protein 10 | XR_001746271.1 | 37.6% | (many diffs) | |
| 6 | human | 26267 | FBXO10 | F-box protein 10 | XR_001746270.2 | 30.4% | (many diffs) | |
| 7 | human | 26267 | FBXO10 | F-box protein 10 | XM_005251439.5 | 17.8% | 17.9% | (many diffs) |
| 8 | mouse | 269529 | Fbxo10 | F-box protein 10 | NM_001024142.1 | 44% | 47.1% | (many diffs) |
| 9 | mouse | 269529 | Fbxo10 | F-box protein 10 | XM_017320234.1 | 43.1% | 46.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1512
- ORF length:
- 1443
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gctcaggaac gacatttacc gctgccgagc gtcaggcatc tttcttcgct 121 tggagggcgg tggcttgatt gccggcaaca acatttacca caatgcagag gctggtgtag 181 acatccggaa aaagtccaac ccactcatac tgtgtaacca gatccaccat ggccttcgct 241 ctggcattgt cgtccttggc aatgggaaag gcatcatccg gaacaatcaa atcttttcca 301 ataaggaggc tggcatttac atcctgtacc acggaaaccc cgttgtgagc gggaaccaca 361 tcttcaaggg ccgtgctgcc ggcatagcag tgaatgagaa cggcaaaggc ctcatcacag 421 aaaatgtcat ccgtgagaat cagtggggag gtgtggacat ccgccgtgga gggatccccg 481 ttctcaggag taacctcatc tgctttggct attcagatgg tgtggttgtg ggagacgaag 541 gcaaaggcct catagaagga aataccatct acgctaacaa gggctgtggt gtgtggatga 601 tgtcgtccag cctcccccat gtcaccagca atcacgtcag ctacaatggc ctgtatggag 661 tggcagtatt tagccagaag gatggctcca gcgagttacc tcgaggccac agggctcaag 721 agaacttcag cgaggatggg gacgccatcc tctgggagac agagctggag aaggaggacg 781 acccactgcg ccggcccatc accatagctc ttgttgagtc taacagtatt aatcacaatg 841 gagcctcagg actctatgtc cagagcagcg aggcactgca tgtcatcacc aatgtgatcc 901 acgcgaatgg ggacagaggc attactgtgg cccagagcag ccaacccacc cgagtggcca 961 acaacagcat ctcctgcaac cggcaaagtg gggtcaaggt tgaggcccag tgcaaagtgg 1021 agctccgggg caatggtatc tatgacaaca gaggccacgg cattatcacc aagggcgaca 1081 gcaccatcgt cattgaaaac gatatcattg gcaaccgggg cagcgggctg cagctgctgc 1141 ccaggtccga cactaaagta ataaagaacc ggatccactc gttccgggcc TACGGCATCG 1201 CCGTGCGGGG CCGTGCCAAG GCCCTGGTGC AGGAAAACAT CATCTTCCAG GGCAAAACCA 1261 GTAAGACCAT CTTTCAGCAG ATCTCAAACA ACCGAGAATG CATCATGCAA AACAACAAGT 1321 TCCTGGTCTT CAAGAAAAAG TCTGATACGT GGCGCCTGGT GAACCCACCA GCACGGCCCC 1381 ACCTTGAAAA TTCTCTCAGA CGTCCCTCGG CAGCCCACAA TGGGCAGAAG GTGACAGCCA 1441 TGGCAACGAG GATCACAGCC CGGGTGGAAG GTGGTTACCA CAGCAACCGC AGTGTCTTCT 1501 GCACCATCCT GTTGCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1561 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1621 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGATAA CGCTGTCCAA CGACTGAAGG 1681 AACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t