Transcript: Human NM_001024383.2

Homo sapiens neuron navigator 3 (NAV3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
NAV3 (89795)
Length:
10219
CDS:
569..7726

Additional Resources:

NCBI RefSeq record:
NM_001024383.2
NBCI Gene record:
NAV3 (89795)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001024383.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107068 CCAGTCCTTATCTAAGCCTAT pLKO.1 2254 CDS 100% 4.050 5.670 N NAV3 n/a
2 TRCN0000310383 CCAGTCCTTATCTAAGCCTAT pLKO_005 2254 CDS 100% 4.050 5.670 N NAV3 n/a
3 TRCN0000218037 CAATTACCCAAAGGTACTTTA pLKO_005 6678 CDS 100% 13.200 10.560 N Nav3 n/a
4 TRCN0000303440 CAATTACCCAAAGGTACTTTA pLKO_005 6678 CDS 100% 13.200 10.560 N NAV3 n/a
5 TRCN0000107067 CGTCTCTTTAAGGAATATGTA pLKO.1 6443 CDS 100% 5.625 4.500 N NAV3 n/a
6 TRCN0000107066 GCACTGTTCTTCAAGACCTTT pLKO.1 673 CDS 100% 4.950 3.960 N NAV3 n/a
7 TRCN0000107069 GCAGAAATCATCCAGATTATT pLKO.1 908 CDS 100% 15.000 10.500 N NAV3 n/a
8 TRCN0000299127 GCAGAAATCATCCAGATTATT pLKO_005 908 CDS 100% 15.000 10.500 N NAV3 n/a
9 TRCN0000303441 GGTCGATGTGGGTGGATATAT pLKO_005 3010 CDS 100% 15.000 10.500 N NAV3 n/a
10 TRCN0000107065 GCCTTGTGAATAGATCGCTTT pLKO.1 8729 3UTR 100% 4.050 2.835 N NAV3 n/a
11 TRCN0000299126 GCCTTGTGAATAGATCGCTTT pLKO_005 8729 3UTR 100% 4.050 2.835 N NAV3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001024383.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.