Transcript: Mouse NM_001024478.1

Mus musculus cadherin-related family member 3 (Cdhr3), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Cdhr3 (68764)
Length:
2953
CDS:
102..2597

Additional Resources:

NCBI RefSeq record:
NM_001024478.1
NBCI Gene record:
Cdhr3 (68764)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001024478.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094235 GCTCACTTTCAGCATTATGTT pLKO.1 1142 CDS 100% 5.625 7.875 N Cdhr3 n/a
2 TRCN0000094238 CCAGGTGACTATTGTGAACAT pLKO.1 767 CDS 100% 4.950 6.930 N Cdhr3 n/a
3 TRCN0000094234 CCACTATTCTCTTCATCGTTA pLKO.1 2618 3UTR 100% 4.950 3.465 N Cdhr3 n/a
4 TRCN0000094237 CCCATCATTTCTCTGGAAGTT pLKO.1 1026 CDS 100% 4.950 3.465 N Cdhr3 n/a
5 TRCN0000094236 CCCTAAACACACAGGGAGATA pLKO.1 2576 CDS 100% 4.950 3.465 N Cdhr3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001024478.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.