Transcript: Human NM_001024678.4

Homo sapiens leucine rich repeat containing 24 (LRRC24), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
LRRC24 (441381)
Length:
1762
CDS:
134..1675

Additional Resources:

NCBI RefSeq record:
NM_001024678.4
NBCI Gene record:
LRRC24 (441381)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001024678.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180698 GCTGGATTTCACCTTCTTGCA pLKO.1 544 CDS 100% 2.640 2.112 N LRRC24 n/a
2 TRCN0000267505 CCATTGGTGACCTGGAGAAAG pLKO_005 998 CDS 100% 10.800 7.560 N LRRC24 n/a
3 TRCN0000267496 ACAGCAGCCTCATCTGCATTC pLKO_005 888 CDS 100% 6.000 4.200 N LRRC24 n/a
4 TRCN0000267490 AGCGCTGTTCGTCAACGACTA pLKO_005 1459 CDS 100% 4.050 2.835 N LRRC24 n/a
5 TRCN0000180130 CATGCTCTTCCTCAGCAACAT pLKO.1 1117 CDS 100% 4.950 2.970 N LRRC24 n/a
6 TRCN0000254764 CCAGGGACAGGAAGATCATGT pLKO_005 819 CDS 100% 4.950 2.970 N LRRC24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001024678.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.