Transcript: Mouse NM_001024926.3

Mus musculus cytochrome b5 domain containing 2 (Cyb5d2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Cyb5d2 (192986)
Length:
2393
CDS:
78..869

Additional Resources:

NCBI RefSeq record:
NM_001024926.3
NBCI Gene record:
Cyb5d2 (192986)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001024926.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000204691 GCCGGTCTTGTGGATGATATA pLKO.1 372 CDS 100% 13.200 18.480 N Cyb5d2 n/a
2 TRCN0000215878 CAGCTTTCTTTACTCATATTG pLKO.1 1534 3UTR 100% 13.200 9.240 N Cyb5d2 n/a
3 TRCN0000215619 GGTAATTGACTGAGCTCTTAA pLKO.1 1346 3UTR 100% 13.200 9.240 N Cyb5d2 n/a
4 TRCN0000187653 GTAGAAGCCATGGTGACTAAA pLKO.1 528 CDS 100% 13.200 9.240 N Cyb5d2 n/a
5 TRCN0000189219 GCTGCACAACTGGCTTTCATT pLKO.1 422 CDS 100% 5.625 3.938 N Cyb5d2 n/a
6 TRCN0000187740 GAGGCAAATGAACAGGAACAA pLKO.1 555 CDS 100% 4.950 3.465 N Cyb5d2 n/a
7 TRCN0000188765 GATGGGTTACCCACTTCAGAA pLKO.1 498 CDS 100% 4.950 3.465 N Cyb5d2 n/a
8 TRCN0000187652 GCATTTGTGACAGGAGACTAT pLKO.1 345 CDS 100% 4.950 3.465 N Cyb5d2 n/a
9 TRCN0000204083 GTGACAGGAGACTATTCTGAA pLKO.1 351 CDS 100% 4.950 3.465 N Cyb5d2 n/a
10 TRCN0000204521 CCCAGGAAGTTGTATAAGCCA pLKO.1 687 CDS 100% 0.750 0.525 N Cyb5d2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001024926.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.