Transcript: Human NM_001025231.2

Homo sapiens keratinocyte proline rich protein (KPRP), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
KPRP (448834)
Length:
2527
CDS:
64..1803

Additional Resources:

NCBI RefSeq record:
NM_001025231.2
NBCI Gene record:
KPRP (448834)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001025231.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000282254 TATCGGTCCCGGACTTCATTT pLKO_005 724 CDS 100% 13.200 18.480 N KPRP n/a
2 TRCN0000262509 CGCCGCTCTGAACCCATATAT pLKO_005 958 CDS 100% 15.000 12.000 N KPRP n/a
3 TRCN0000262511 ATATTCAGAGACTCCCTATTA pLKO_005 1901 3UTR 100% 13.200 9.240 N KPRP n/a
4 TRCN0000262512 TCAGACTTGCTTCGTAGAATG pLKO_005 447 CDS 100% 10.800 7.560 N KPRP n/a
5 TRCN0000180064 CGTCACAACCTGTTCAGACTT pLKO.1 434 CDS 100% 4.950 3.465 N KPRP n/a
6 TRCN0000183550 GAACCTTGTTTGTATCCAGAA pLKO.1 1348 CDS 100% 4.050 2.835 N KPRP n/a
7 TRCN0000262510 CCAAGTGCCGAATCGAGATTT pLKO_005 1031 CDS 100% 13.200 7.920 N KPRP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001025231.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.