Transcript: Human NM_001025239.1

Homo sapiens tetraspanin 4 (TSPAN4), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
TSPAN4 (7106)
Length:
1349
CDS:
322..846

Additional Resources:

NCBI RefSeq record:
NM_001025239.1
NBCI Gene record:
TSPAN4 (7106)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001025239.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380018 TGTACTGCCAAGTGGTCAAGG pLKO_005 806 CDS 100% 4.050 5.670 N TSPAN4 n/a
2 TRCN0000119106 GCCGTGCTACGAGACGGTGAA pLKO.1 693 CDS 100% 0.000 0.000 N TSPAN4 n/a
3 TRCN0000119103 ACGGACAAGATTGACAGGTAT pLKO.1 451 CDS 100% 4.950 3.465 N TSPAN4 n/a
4 TRCN0000119102 CGTATTCTCCAAAGCAGTGTT pLKO.1 1119 3UTR 100% 4.950 3.465 N TSPAN4 n/a
5 TRCN0000380540 GACCTTCGCCATGACCATGTA pLKO_005 789 CDS 100% 4.950 3.465 N TSPAN4 n/a
6 TRCN0000381870 GAGCATCATCCAGACCGACTT pLKO_005 543 CDS 100% 4.050 2.835 N TSPAN4 n/a
7 TRCN0000381200 GTATTCTCCAAAGCAGTGTTC pLKO_005 1120 3UTR 100% 4.050 2.835 N TSPAN4 n/a
8 TRCN0000382234 TGGTCAAGGCAGACACCTACT pLKO_005 818 CDS 100% 4.050 2.835 N TSPAN4 n/a
9 TRCN0000119104 CTCCAACTACACTGACTGGTT pLKO.1 579 CDS 100% 2.640 1.848 N TSPAN4 n/a
10 TRCN0000119105 GCCATGACCATGTACTGCCAA pLKO.1 796 CDS 100% 2.640 1.848 N TSPAN4 n/a
11 TRCN0000382004 GTGCCTCCTGCTCACTTTCTT pLKO_005 369 CDS 100% 5.625 3.375 N TSPAN4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001025239.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07079 pDONR223 100% 73.1% 73.1% None 0_1ins192 n/a
Download CSV