Transcript: Human NM_001025266.3

Homo sapiens chromosome 3 open reading frame 70 (C3orf70), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
C3orf70 (285382)
Length:
7159
CDS:
238..990

Additional Resources:

NCBI RefSeq record:
NM_001025266.3
NBCI Gene record:
C3orf70 (285382)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001025266.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264114 CTTGCTACTATCTACTATATA pLKO_005 3783 3UTR 100% 15.000 21.000 N C3orf70 n/a
2 TRCN0000264112 TCTGCACACGATGCCTTAATT pLKO_005 724 CDS 100% 15.000 21.000 N C3orf70 n/a
3 TRCN0000283825 TCTGCACACGATGCCTTAATT pLKO_005 724 CDS 100% 15.000 21.000 N 2510009E07Rik n/a
4 TRCN0000264111 TTGACAACTATCAGGTTAAAT pLKO_005 629 CDS 100% 15.000 10.500 N C3orf70 n/a
5 TRCN0000264110 ATTAATGGGAAGATGTGTTAT pLKO_005 652 CDS 100% 13.200 9.240 N C3orf70 n/a
6 TRCN0000264113 CACCGAGGTACTGTATGATTT pLKO_005 596 CDS 100% 13.200 9.240 N C3orf70 n/a
7 TRCN0000370788 AGTGATTGAAACGATAGAAAC pLKO_005 960 CDS 100% 10.800 7.560 N C3orf70 n/a
8 TRCN0000370849 ATTAGCTTCTCTCCGTCTTAC pLKO_005 1136 3UTR 100% 10.800 7.560 N C3orf70 n/a
9 TRCN0000370789 CTGAGGACTCTGGGATCAATG pLKO_005 797 CDS 100% 10.800 7.560 N C3orf70 n/a
10 TRCN0000183162 GAAGTGATTGAAACGATAGAA pLKO.1 958 CDS 100% 5.625 3.938 N C3orf70 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001025266.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.