Transcript: Mouse NM_001025380.3

Mus musculus a disintegrin and metallopeptidase domain 39 (Adam39), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Adam39 (546055)
Length:
2441
CDS:
154..2424

Additional Resources:

NCBI RefSeq record:
NM_001025380.3
NBCI Gene record:
Adam39 (546055)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001025380.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201645 CCCACTACATGCAGCATGAAA pLKO.1 2098 CDS 100% 5.625 3.938 N Adam39 n/a
2 TRCN0000191780 GCGAGTTCATTATCATAACAA pLKO.1 849 CDS 100% 5.625 3.938 N Adam39 n/a
3 TRCN0000087574 GCACATGAGATTGGTCATAAT pLKO.1 1213 CDS 100% 13.200 6.600 Y LOC382006 n/a
4 TRCN0000032157 CCAGAGTCTATGGTTGCTATT pLKO.1 553 CDS 100% 10.800 5.400 Y Adam25 n/a
5 TRCN0000192245 CCAGAGTCTATGGTTGCTATT pLKO.1 553 CDS 100% 10.800 5.400 Y Adam39 n/a
6 TRCN0000032158 CCAGAAGTAGTGATACCCTTA pLKO.1 319 CDS 100% 4.050 2.025 Y Adam25 n/a
7 TRCN0000201046 CCAGAAGTAGTGATACCCTTA pLKO.1 319 CDS 100% 4.050 2.025 Y Adam39 n/a
8 TRCN0000087575 CCTATGAGTGAAGAACCCAAA pLKO.1 2344 CDS 100% 4.050 2.025 Y LOC382006 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001025380.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.