Transcript: Human NM_001025434.2

Homo sapiens NAD(P)H quinone dehydrogenase 1 (NQO1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
NQO1 (1728)
Length:
2407
CDS:
122..832

Additional Resources:

NCBI RefSeq record:
NM_001025434.2
NBCI Gene record:
NQO1 (1728)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001025434.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320909 GATTACTATCATGGCATATAA pLKO_005 1005 3UTR 100% 15.000 21.000 N NQO1 n/a
2 TRCN0000003770 CATGTTATCAAATCTGGGTAT pLKO.1 860 3UTR 100% 4.050 5.670 N NQO1 n/a
3 TRCN0000350362 CGAGTCTGTTCTGGCTTATAA pLKO_005 331 CDS 100% 15.000 10.500 N NQO1 n/a
4 TRCN0000003766 AGAAAGGACATCACAGGTAAA pLKO.1 278 CDS 100% 10.800 7.560 N NQO1 n/a
5 TRCN0000003768 TGGAAGAAACGCCTGGAGAAT pLKO.1 629 CDS 100% 4.950 3.465 N NQO1 n/a
6 TRCN0000350361 TGGAAGAAACGCCTGGAGAAT pLKO_005 629 CDS 100% 4.950 3.465 N NQO1 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1715 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000003769 AGACCTTGTGATATTCCAGTT pLKO.1 406 CDS 100% 4.050 2.835 N NQO1 n/a
9 TRCN0000320837 AGACCTTGTGATATTCCAGTT pLKO_005 406 CDS 100% 4.050 2.835 N NQO1 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1715 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001025434.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.