Transcript: Mouse NM_001025559.3

Mus musculus SRY (sex determining region Y)-box 6 (Sox6), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Sox6 (20679)
Length:
8567
CDS:
142..2505

Additional Resources:

NCBI RefSeq record:
NM_001025559.3
NBCI Gene record:
Sox6 (20679)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001025559.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000225809 CCTATATTCCTTCCGAAATAC pLKO_005 405 CDS 100% 13.200 18.480 N Sox6 n/a
2 TRCN0000225811 TGATCCCAAATCAGACTATAG pLKO_005 2445 CDS 100% 10.800 8.640 N Sox6 n/a
3 TRCN0000085945 CCAGCCCTGTAACTCAAGTTA pLKO.1 1250 CDS 100% 5.625 4.500 N Sox6 n/a
4 TRCN0000085946 CCACCTAGAGAAGTACCCAAA pLKO.1 2058 CDS 100% 4.050 3.240 N Sox6 n/a
5 TRCN0000085947 GTTCCCTATATTCCTTCCGAA pLKO.1 401 CDS 100% 2.640 2.112 N Sox6 n/a
6 TRCN0000225812 ATTTAGGTGAAGACGTATTAA pLKO_005 2718 3UTR 100% 15.000 10.500 N Sox6 n/a
7 TRCN0000225810 CTCCGCTCATGATCCCAATTT pLKO_005 938 CDS 100% 13.200 9.240 N Sox6 n/a
8 TRCN0000085944 GCAGCTAAACTACAGCAGTAT pLKO.1 1774 CDS 100% 4.950 3.465 N Sox6 n/a
9 TRCN0000218408 ACATGCATAACTCCAACATTA pLKO_005 1952 CDS 100% 13.200 7.920 N Sox6 n/a
10 TRCN0000085943 CCCAACAACAACAACAAAGTT pLKO.1 2556 3UTR 100% 5.625 3.375 N Sox6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001025559.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.